Efè Cistanche sou fonksyon anti-aje ak iminitè rat modèl ki aje anvan ak apre pwosesis
Mar 08, 2022
Kontakte: Audrey Hu Whatsapp/hp: 0086 13880143964 Imèl:audrey.hu@wecistanche.com
Résumé: Objektif: Pou eksplore diferan pwodwi yo trete nanCistanchesherba nan D - galaktoz anti-aje fonksyon nan rat ak efè fonksyon ògàn iminitè. Metòd: Nou ekstrè diferan pwodwi trete nan Cistanches herba. SD rat yo te owaza divize an gwoup kontwòl vid, gwoup modèl aje, gwoup vitamin E, gwoup cistanche segondè, mwayen, ak ba dòz, diven cistanche segondè, mwayen, ak gwoup dòz ki ba. Avèk D - galaktoz aje rat modèl te etabli, apre tretman an, nou detekte sa ki nan MDA, SOD, ak NO nan serom nan chak gwoup rat epi konte endèks larat ak endèks tim; ak Lè sa a, obsève chanjman yo patolojik mòfolojik nan tisi larat ak mtDNA nan sèvo a. Rezilta: MDA ak NO nan serom rat modèl ki aje yo te ogmante anpil (P<0. 01)="" and="" sod="" decreased="" significantly="" (fvo.="" 01).="" the="" model="" group="" had="" a="" tendency="" to="" decrease,="" thymus="" and="" spleen="" coefficient="" had="" obvious="" pathological="" spleen="" injury,="" and="" mtdna="" in="" the="" brain="" was="" missing.="" different="" processed="" products="" of="">0.>Cistanchesherba ka siyifikativman redwi MDA a ak NO (P<0. 01="" or="" p="">0.><0. 05).="" sod="" had="" a="" rising="" trend,="" improving="" the="" spleen="" index="" and="" thymus="" index,="" improving="" the="" pathological="" injury="" of="" the="" spleen.="" the="" mtdna="" in="" the="" brain="" of="" the="" high="" dose="" group="" and="" positive="" medicine="" group="" did="" not="" miss.="" and="" processing="" products="" were="" better="" than="" the="" raw="" cistanches="" herba.="" the="" high="" dose="" group="" was="" better="" than="" the="" low="" dose="" group.="" conclusion:="" different="" processing="" products="" of="" cistanches="" herbs="" have="" different="" anti-aging="" effects="" and="" immune="">0.>
Mo kle: Cistanches herba; pwosesis; aje; iminitè
Medsin tradisyonèl Chinwa aCistanche deserticolaYC Ma orCistanche deserticolaYC Ma oswa C. tubulosa (Schenk) Wight se tij chèch, kalm chèchCistanche deserticola(Schenk) Wight. Li se cho nan lanati, dous ak sale nan gou, epi li se nan ren an ak gwo entesten Meridian. Li esansyèl pou ranfòse ren an ak ranfòse Yang Medsin yo rele "dezè ginseng" (2). Cistanche te premye pibliye nan "Shen Nong's Materia Medica". Li nan lis kòm klas ki pi wo a. Li gen efè ranpli esans ak mwèl nourisan, nouri ren an ak ranfòse Yang, koulè plezi ak pwolonje lavi, nourisan san ak sechrès idrate, elatriye Li ka trete lakòz fi, enpotans gason, konstipasyon san sèk, ren frèt, ak jenou. . Maladi tankou doulè, pyèj, efondreman san, elatriye! 3_5]o Edisyon 2010 "The Pharmacopoeia of the People's Republic of China" genyen ladan liCistanche tubulosaepiCistanche E.
Kòm laj kò a, pral gen kèk degradasyon nan tou de fonksyon fizyolojik ak estrikti mòfolojik. Sa a se sa nou rele souvan "aje". Manifestasyon li yo se sitou deteryorasyon nan ògàn, tisi, ak selil, tankou diminisyon nan elastisite tisi, atrofi a nan ògàn, ak diminisyon nan kantite selil, ki pral lakòz anpil fonksyon kò a piti piti deperi. Eksperyans yo te konfime saCistanchegen efè anti-aje "mwen", men etid konparatif sou efè anti-aje nanCistancheanvan ak apre pwosesis yo poko rapòte. Eksperyans sa a sitou etidye laefè anti-ajenanCistancheanvan ak apre pwosesis epi li bay yon baz syantifik pou etidye mekanis nan aje.
Echinacoside
1 Materyèl eksperimantal
1.1 Bèt eksperimantal
SD rat, ki peze 180-220 g. SPF te bay Liaoning Changsheng Biotechnology Co., Ltd., nimewo lisans: SCXK (Liao) 2015-0001.
1.2 Dwòg ak reyaktif
Cistanchete achte nan men Alashan sann vyann sovaj nan Mongoli Entèn, e li te idantifye kòm tij la chèch chèch ak fèy echèl nanCistanche deserticolaYC Ma pa Pwofesè Zhai Yanjun nan lopital nou an; metòd preparasyon chak gwoup sibstans tès yo se jan sa a, kri cistanche: kri Cistanche a vapè pou 2 èdtan, koupe an tranch 6 mm epè, epi sèk nan 70P. Pran tranch Cistanche ak ekstrè 3 fwa nan dlo, Lè sa a, konbine dekoksyon an ak konsantre nan yon sèten konsantrasyon. Preparasyon Cistanche: Pran kri Cistanche epi tranpe nan diven jòn pou 8 èdtan, ajoute 1:1, vapè pou 16 èdtan, koupe an tranch 6 mm epè, epi sèk nan 70 T. Pran tranch yo Cistanche epi ekstrè 3 fwa ak dlo, Lè sa a, konbine dekoksyon an epi konsantre li nan yon sèten konsantrasyon. Vitamin E kapsil mou (nimewo pakèt 1407061, Shenyang Hongqi Pharmaceutical Co., Ltd.); D-galaktoz (nimewo pakèt 710B055, Beijing Soleibao Technology Co., Ltd.); Twous oksid nitrique (NO) (nimewo pakèt: BPE30262); Malondialdehyde (nimewo pakèt: BPE30262) MDA) twous (nimewo pakèt BPE30527); superoksid dismutase (SOD) twous (nimewo pakèt: BPE3O387); tout bay Shanghai Langdon Biotechnology co, Ltd.; twous ekstraksyon ADN mitokondrial bèt kolòn-kalite (achte nan Beijing Lab Technology Co., Ltd.); Kit PCR (achte nan men TIANGEN Reagent Company); lòt reyaktif yo domestik pi bon kalite.
1.3 Ekipman eksperimantal
Gene cycler (Hangzhou Longkey Scientific Instrument Co, Ltd.); Lektè Microplate (Thermo Fisher Technology Co., Ltd., USA); Konstan tanperati ak imidite chanm (Shanghai Yiheng Scientific Instrument Co., Ltd.); TGL-16C tip di machin santrifujeur benchtop (Shanghai Anting Scientific Instrument Factory); Vortex Mixer (Shanghai Qingpu Huxi Enstriman Faktori); Elektwonik Balans (Shanghai Yousheng Peze Aparèy Co, Ltd.); Vortex Mixer (Shanghai Qingpu Huxi Enstriman Faktori).
2 Metòd eksperimantal
2.1 Modèl bèt ak gwoupman
Apre 1 semèn nan manje adaptasyon, rat yo te owaza divize an yon gwoup vid, yon gwoup modèl, yon gwoup kontwòl, yon gwoup.Cistanchesegondè, mwayen, ak gwoup dòz ki ba, ak B. striata: segondè, mwayen, ak gwoup dòz ki ba, chak nan yo ki te 9 gwoup 8 moso. Eksepte pou gwoup la vid, lòt gwoup yo te enjekte ak D-galaktoz 167.5 mg / kg anba lar nan maten an; gwoup vid la te sou fòm piki ak yon volim egal nan saline nòmal; nan apremidi a, dòz segondè, mwayen ak ba nan sann vyann ak diven yo te bay 5.48 ak 2 respektivman. 74, 1.37 g / kg nan solisyon an pwodwi tès, yo te bay gwoup la kontwòl pozitif 2.75 mg / mL vitamin E, gwoup la vid ak gwoup la modèl yo te bay yon volim egal nan saline nòmal pa administrasyon entragastric. Pou 6 semèn youn apre lòt, yo te finalman touye yo ak divès kalite endikatè yo te mezire.
2.2 Detèminasyon kontni SOD, MDA, ak NO nan serom rat
Yo te kolekte san nan aorta vant rat la, santrifuje a 3000 r/min pou 15 minit pou separe serom san an, epi estoke nan -20 Y pou itilize pita. MDA.SOD.NO detèminasyon kontni fèt an akò ak enstriksyon yo nan twous tès la.
2.3 Efè sou pwa ògàn iminitè nan rat modèl ki aje
Yo te peze rat yo nan chak gwoup epi yo te sakrifye apre yo fin pran san. Larat ak tim yo te pran, lave ak saline, seche, epi peze, epi yo te kalkile koyefisyan larat ak tim.
2.4 Obsèvasyon mòfoloji tisi larat
Larat yo peze yo te fikse ak 4 pousan paraformaldehyde, entegre nan parafine, seksyone, ak tache ak HE. Chanjman yo nan seksyon patolojik nan larat nan chak gwoup yo te obsève anba yon mikwoskòp.
2.5 Metòd estatistik
Sèvi ak lojisyèl SPSS pou fè yon analiz yon sèl-fason nan divèjans ak LSD-t-tès pou konparezon par.
2.6 Deteksyon mitasyon mtDNA nan sèvo a
Tisi nan sèvo rat yo te mete nan yon mòtye ak nitwojèn likid, byen vit mouye nan poud, ak Lè sa a, refere yo bay metòd la literati, dapre enstriksyon yo twous pou fè ekstraksyon tisi nan sèvo mtDNA.
Anplifikasyon PCR detekte efase fragman mtDNA4834: primè yo refere a sekans konplè nan jenom mtDNA rat rapòte pa Gada-leta et al. (1898), ak primè yo sentèz pa Shanghai Shengang Endistriyèl Co, Ltd. Pl: 5'-GCGAAGCTTAGAGGCGTTAAC-3'P2: 5'AGTGAGATAAGGAAGCCTGC -3' P3: 5'-AG- GACTTAACCAGACCCAAAGACG{ {13}}, P4: 5'-CCTCTTTTCTGATAGGGCGGG-3,
Sistèm reyaksyon PCR: modèl ADN 1 |xL, 2 x Taq PCR MasterMix 25 |xL, ddH2O 20 jiL, 2 primè chak. Kondisyon anplifikasyon: premye 95 Y denaturasyon pou 5 min; 95 T denaturasyon pou 30 s, 56 T annealing pou 30 s, 72 T ekstansyon pou 45 s, yon total de 35 sik; dènye ekstansyon 72 T pou 7 minit. Pwodwi yo anplifye yo te sibi 1.5 pousan agarose jèl elektwoforèz.

Acteoside
3 Rezilta ak analiz
3.1 Efè a nanCistanchesou siy fizik rat aje
Konpare ak gwoup la vid, rat yo aje te montre rad nwa ak jòn, po ki lach ak mat, po ki lach, pèt cheve, pèt apeti, redwi aktivite espontane, ralantisman mouvman, bonbe kolòn vètebral, apati, repons dousman ak lòt manifestasyon aje. Plis tan piki a, plis sentòm yo evidan. Konpare ak gwoup moun ki aje, eta mantal rat yo, koulè rad, apeti, fòm kò, ak sansiblite reyaksyon amelyore ak ogmantasyon tan administrasyon an nan chak gwoup administrasyon.Cistanche. Pami yo, te fondamantalman pa gen okenn diferans ant gwoup la pwodwi gwo dòz ak gwoup kontwòl la.
3.2 Efè a nanCistanchesou kontni MDA, SOD, ak NO nan serom rat modèl ki aje
Yo montre rezilta yo nan Tablo I. Konpare ak gwoup vid la, gwoup modèl mda.no a te ogmante anpil (P<0.01), and="" sod="" was="" significantly="" reduced="" (p="">0.01),><0.01); compared="" with="" the="" model="" group,="" each="" treatment="" group="" mda.no="" was="" significantly="" lower="">0.01);><0.01 or="">0.01><0.05), sod="" has="" a="" rising="" trend,="" but="" it="" is="" not="" statistically="" significant;="" compared="" with="" the="" high-dose="" group="" of="">0.05),>Cistanche, MDA.N0 nan mitan ak ti dòz gwoup Cistanche yo te siyifikativman redwi (F<0.05 ),="" sod="" tends="" to="" increase;="" compared="" with="" the="" high-dose="" group="" of="" cistanche,="" the="" mda.no="" of="" the="" middle="" and="" low-dose="" groups="" of="" cistanche="" rose="" significantly="" (p="">0.05><0.01 or="" p="">0.01><0.05), and="" the="" sod="" tended="" to="" decrease;="" compared="" with="" the="" jiu="" nvrong="" gao="" dose="" group,="" the="" mda.no="" of="" the="" high-dose="" eggplant="" paste="" group="" increased="" significantly="" (p="">0.05),><0.01), and="" sod="" tended="" to="" decrease.="" this="" result="" shows="" that="" the="" high-dose="" group="" is="" better="" than="" the="" low-dose="" group="" compared="" with="" different="" dose="" groups,="" and="" the="" treatment="" effect="" of="" the="" product="" group="" is="" better="" than="" that="" of="" the="" raw="" product="" group="" compared="" with="" the="" same="" dose="" group.="">0.01),>
3.3 laefè Cistanchesou fonksyon iminitè rat modèl ki aje Chi
3.3.1 Efè Cistanche sou endèks larat ak timis rat modèl ki aje
Rezilta yo montre nan Tablo 2. Konpare ak gwoup vid la, koyefisyan timis ak larat nan gwoup modèl la se g.
Gen yon tandans diminye, men li pa estatistik enpòtan. Konpare ak gwoup modèl la, timis ak koyefisyan larat chak gwoup tretman yo te ogmante anpil (F<0.05); compared="" with="" the="" high-dose="" cistanche="">0.05);>
Gwoup konparezon, tim yo ak koyefisyan larat nan mitan ak ba gwoup dòz laCistanchegen tandans diminye
Potansyèl; konpare ak gwo dòz laCistanche deserticolagwoup ki gen gwo dòz, timis la, ak larat nan mitan ak ti fi diven gwoup keratin
Koefisyan visceral la gen yon tandans diminye; konpare ak gwo dòz laCistanche deserticolagwoup dòz segondè, timis la ak koyefisyan larat nan gwo dòz lacistanche deserticolaGwoup dòz gen yon tandans diminye. Rezilta sa a montre ke gwoup dòz segondè a pi bon pase gwoup dòz ki ba a konpare ak gwoup dòz diferan, ak efè tretman gwoup pwodwi a pi bon pase gwoup pwodwi anvan tout koreksyon konpare ak gwoup dòz la menm.
Tablo 1 Konparezon kontni SOD.MDA.NO nan san rat nan chak gwoup (n. =8,x ±s)

Remak:. Konpare ak gwoup modèl mwen an, P<005.>005.><001; j="" air-day="" group="" comparison.="">001;><[)01; tlilll="" high-dose="" ether="" group="" jqi="" [i_low-dose="" group="" comparison.="">[)01;><005.>005.><(). ()1;="" the="" high-dose="" product="" group="" is="" compared="" with="" the="" product="" tl="" and="" ff="" [journal="" f="" group.="" })="">().><0.05.1l>0.05.1l><(1o1; product="" high="" yanlian="" group="" q.="" pindaoli="" {group="" comparison.="">(1o1;><005.>005.><>

3.3.2 Efè a nan chanjman patolojik nan larat la nanCistancherat modèl ki aje. Gwoup la vid gen yon kapsil larat mens ak inifòm, trabeculae larat klè san anfle, separasyon klè nan kaka wouj ak blan, plis nodil larat, ak menm gwosè a, nan sant la nan larat la Kantite selil ki nan djenn lenfatik la alantou an. arteriol se dans. Nan gwoup modèl la, larat la te epesè, trabecula a ak cortical yo te anfle, kaka wouj ak blan an te klè, kaka blan an te siyifikativman redwi, kantite lenfosit yo te redwi, yon gwo kantite selil enflamatwa yo te enfiltre, ak la. estrikti mòfolojik te domaje. Malgre ke gwosè nodil larat yo nan chak gwoup tretman te diferan, fwontyè kaka blan ak wouj yo te klè. Kantite selil ki nan djenn lenfatik alantou ti atè santral larat la te dans, epi mòfoloji ak estrikti yo te retabli. Anplis, gwoup distilateur gwo dòz la te kapab amelyore chanjman patolojik yo. Li pi bon pase vitamin E gwoup la, nan ki laCistanchepwodwi se pi bon pase gwoup la pwodwi anvan tout koreksyon, ak gwoup la gwo dòz se pi bon pase gwoup la ki ba-dòz. Gade insert X-XI insert.1-10 se ADNmt nan sèvo rat nan gwoup vid, gwoup modèl, gwoup kontwòl, ak gwoup ki wo. mtDNA Figi 3 Rezilta elektwoforèz pwodwi anplifikasyon mtDNA PCR nan sèvo rat (primer PI.P2)
3.4 Suppression ak mitasyon mtDNA nan sèvo a
Dapre primè P3 ak P4, yo ka jwenn yon fragman mtDNA konsèvatif sou 770bp. Soti nan Figi 2 nou ka wè ke fragman sib yo te anplifye nan tout liy 9, ki endike ke tout 9 gwoup mtDNA yo te ekstrè avèk siksè.
Determination of mtDNA4834 bp deletion mutation: If there is a rat mtDNA4834 bp deletion, primers P1 and P2 will amplify the 4834 bp loss and break the fusion gene fragment with a length of 597 bp. As shown in Figure 3, there is a clear DNA band between 500 l>p ak 750 bp nan liy 2, 4, 5, 7, 9, ak 10. Fragman yo te refè epi voye bay Hangzhou Baocheng Biotechnology Company pou sekans. Konpare ak sekans ki rapòte pa Gadateta et al. (1989), li te pwouve ke gen yon efase nan fragman mtDNA apeprè 4000-5000 bp. Se poutèt sa, li montre ke gen apeprè 4834 bp sipresyon mtDNA nan sèvo gwoup modèl la. Liy 1, 3, ak 8 pa gen okenn fragman, ki endike ke pa gen okenn efase fragman mitokondriyo nan 1, 3, ak 8. Rezilta yo te montre ke pa te gen okenn fragman ki manke nan gwoup ledven distilateur gwo dòz la, gwoup dwòg la pozitif, ak gwoup la vid, sijere ke gwoup ledven distilatè a gwo dòz ka gen efè anti-aje. Gade Figi 2 ~ Figi 3.
1-10 se ADNmt nan sèvo rat nan gwoup vid, gwoup modèl, gwoup kontwòl, ak gwoup ki wo. mtDNA Figi 3 Rezilta elektwoforèz pwodwi anplifikasyon mtDNA PCR nan sèvo rat (primer PI.P2)

Cistanche: anti-aje
4 Diskisyon
Modèl aje ki te koze pa administrasyon entragastric D-galaktoz se kounye a yon modèl aje ki pi souvan itilize. Modèl la sitou diminye aktivite a nan yon varyete de anzim antioksidan, se konsa ke yon gwo kantite radikal gratis yo pwodwi pandan metabolis la nan kò a, ki mennen nan aje nan kò a. Chanjman yo nan mòfoloji tisi yo sanble ak sa yo ki nan aje natirèl ⑻. Yon gwo kantite eksperyans yo te montre ke D-galaktoz-induit ogmantasyon nòmal nan kontni NO nan sèvo a ak cortical serebeleux ak san nan sourit aje. Rezilta yo nan etid sa a konfime ke kontni an san nan rat aje te siyifikativman pi wo pase sa yo ki nan gwoup la nòmal, ki te menm jan ak rezilta yo rapòte nan literati "-m.
Nan eksperyans sa a, efè a anti-aje nan modèl la aje nan rat anvan ak apre pwosesis la nanCistanchete etidye. Rezilta yo te montre serik MDA ak N nan rat modèl ki aje yo. Siyifikativman ogmante (P<0.01), sod="" significantly="" decreased="" (p="">0.01),><0.01), the="" model="" group="" thymus="" and="" spleen="" coefficients="" have="" a="" tendency="" to="" decrease,="" the="" spleen="" has="" obvious="" pathological="" damage,="" and="" mtdna="" in="" the="" brain="" is="" also="" missing.="" different="" processed="" meat="" ash="" can="" significantly="" reduce="" the="" levels="" of="" mda="" and="" no="" (/=""><0.01 or="">0.01><0.05), sod="" has="" a="" rising="" trend,="" increase="" spleen="" index="" and="" thymus="" index,="" improve="" spleen="" pathological="" damage,="" and="" high="" mtdna="" in="" the="" brain="" the="" dose="" group="" and="" the="" positive="" drug="" group="" also="" did="" not="" appear="" to="" be="" missing.="" and="" the="" prepared="" meat="" puree="" is="" better="" than="" the="" raw="" meat="" puree,="" and="" the="" high-dose="" group="" is="" better="" than="" the="" low-dose="" group.="" research="" in="" recent="" years="" believes="" that="" aging="" is="" also="" related="" to="" the="" lipid="" peroxidation="" of="" biological="" membranes="" caused="" by="" free="" radicals.="" sod="" "'-e="" is="" an="" enzyme="" that="" scavenges="" superoxide="" free="" radicals.="" the="" older="" the="" body,="" the="" weaker="" the="" body's="" sod="" activity="" and="" the="" fewer="" antioxidants.="" this="" will="" increase="" the="" free="" radical="" damage="" factor="" mda,,4~,7],="" and="" eventually="" accelerate="" aging.="" in="" addition,="" the="" results="" of="" the="" thymus="" and="" spleen="" coefficients="" of="" aging="" model="" rats="" indicate="" that="" roujing="" rong="" can="" delay="" aging="" by="" improving="" the="" immune="" function="" of="" the="" body.="" the="" results="" of="" the="" study="" hope="" to="" provide="" a="" scientific="" basis="" for="" the="" clinical="" application="" of="">0.05),>Cistanche.








