Metformin soulaje defisyans nerokognitif nan aje grasa aktivasyon AMPK/BDNF/PI3K Pathway PATI 1

Ralanti andikap nerokognitif ki gen rapò ak laj te yon defi. Nou evalye efè terapetik metformin nan aje d-galaktoz pwovoke. Anplis de sa, nou etidye mekanis molekilè potansyèl ki ta ka responsab efè anti-aje metformin la. Trant gason rat yo te egalman divize an 1-gwoup kontwòl, ki te resevwa yon solisyon saline, 2-d-galaktoz (D-gal) gwoup, ki te resevwa d-galaktoz (100 mg / kg / jou) pa lavaj gastric pandan uit semèn, ak 3—d-galaktoz plis metformin (D-gal plis Met) gwoup trete, ki te resevwa d-galaktoz plis metformin (200 mg/kg/jou) pa lavaj gastric pandan uit semèn. Yo te fè yon evalyasyon nerokognitif. Yo te fè mezi enflamatwa, estrès oksidatif, ak byomarkè BDNF. AMPK ak ekspresyon jèn PI3K yo te evalye. Tisi ipokanp yo te diseke pou etid istopatolojik ak imunohistochimik. D-gal te lakòz defisyans nerokognitif, elevasyon byomarkè enflamatwa, makè estrès oksidatif ki chanje, diminye BDNF, ak diminye ekspresyon sinaptofizin ak Bcl2 ak ogmante ekspresyon Caspase -3, ak desann-règleman AMPK ak jèn PI3K. Chanjman newodegenerative yo te prezan nan ipokanp la. Metformin retabli siyifikativman D-gal-induit chanjman neurodegenerative. Nou konkli ke metformin te kapab soulaje defisi nerokognitif laj-pwovoke atravè amelyorasyon nan neroenflamasyon, diminisyon nan estrès oksidatif, rediksyon nan apoptoz, osi byen ke pwomosyon nan plastisit sinaptik. Mekanis sa yo ka medyatè atravè aktivasyon chemen AMPK/BDNF/PI3K.

Glycoside nan cistanche ka ogmante tou aktivite SOD nan kè ak tisi fwa, ak siyifikativman redwi kontni an nan lipofuscin ak MDA nan chak tisi, efektivman scavenging divès kalite radikal oksijèn reyaktif (OH-, H₂O₂, elatriye) ak pwoteje kont domaj ADN ki te koze. pa OH-radikal. Cistanche phenylethanoid glikozid gen yon gwo kapasite scavenging nan radikal gratis, yon pi wo kapasite diminye pase vitamin C, amelyore aktivite a nan SOD nan sispansyon espèm, redwi kontni an nan MDA, epi yo gen yon sèten efè pwoteksyon sou fonksyon manbràn espèm. Cistanche polisakarid ka amelyore aktivite SOD ak GSH-Px nan eritrosit ak tisi nan poumon sourit eksperimantal senesan ki te koze pa D-galaktoz, osi byen ke diminye kontni an nan MDA ak kolagen an nan poumon ak plasma, ak ogmante kontni an nan elastin, gen yon bon efè scavenging sou DPPH, pwolonje tan an nan ipoksi nan sourit senesan, amelyore aktivite a nan SOD nan serom, ak retade koripsyon fizyolojik nan poumon nan sourit senesan eksperimantal Avèk koripsyon selilè mòfolojik, eksperyans yo te montre ke Cistanche gen bon kapasite antioksidan. epi li gen potansyèl pou yo dwe yon dwòg pou anpeche ak trete maladi po aje. An menm tan an, echinacoside nan Cistanche gen yon kapasite siyifikatif pou retire radikal gratis DPPH epi li ka retire espès oksijèn reyaktif, anpeche degradasyon kolagen an gratis radikal-induit, epi tou li gen yon efè reparasyon bon sou domaj anyon radikal gratis timin.

Klike sou Cistanche nan Oudou sou ANTI AING

【Pou plis enfòmasyon: david.deng@wecistanche.com / WhatApp:86 13632399501】

Abreviyasyon yo

D-gal d-galaktoz

ROS espès oksijèn reyaktif

IL-1 Interleukin-1

IL-1 Interleukin-1

IL-6 Interleukin-6

IL-10 Interleukin-10

TNF- Faktè necrosis timè

BDNF Faktè nerotwofik ki sòti nan sèvo

AMPK AMP-aktive pwoteyin kinaz

PI3K/Akt Phosphatidylinositol 3-kinaz/pwoteyin kinaz B

RT-PCR Reverse transcriptase polymerase chèn reyaksyon

EPM Elevated plis labirent

Latansi transfè TL

MDA Malondialdehyde

SOD Superoxide dismutase

MPTP mitokondriyo pèmeyabilite tranzisyon pò

H&E ematoksilin ak eozin

iNOS Inductible nitrique oksid synthase

NF-κB Faktè nikleyè-κB

LTP Potansyasyon alontèm

Pèt konstan nan fonksyon fizyolojik, ladrès mantal, ak memwa ki rive ak aje se yon pwosesis plizyè aspè ki ka deklanche pa lanmò selil newòn1. Esperans lavi a nan anpil peyi prevwa depase 85 ane pa 20302. Akoz kalite lavi a diminye pou granmoun aje yo ak depans ekonomik ak pèsonèl ki asosye yo, pwoblèm mantal ki gen rapò ak aje parèt kòm yon pwoblèm sosyal enpòtan. Anplis de sa, aje nan sèvo se kòz prensipal devlopman nan maladi neurodegenerative ki souvan pwogrese irevokabl3. Gen kèk tretman efikas oswa pa gen okenn tretman ki disponib kounye a pou andikap nerokognitif ki gen rapò ak aje4.

D-galaktoz (D-gal), yon monosakarid abondan nan pwodwi lèt, nòmalman konvèti nan glikoz pa anzim. Sepandan, administrasyon D-gal sistemik alontèm ka poze gwo danje pou sante5. Rechèch anvan yo te sigjere ke livrezon sistemik D-gal ki pèsistan bay rat te kapab transfòme yo an modèl nan aje ak maladi neurodegenerative ki gen rapò ak laj6. Modèl aje D-gal la gen plizyè avantaj sou modèl la aje natirèl, ki gen ladan kapasite nan konsantre sèlman sou pwosesis la aje. Nan modèl aje natirèl la, komorbidite ki gen ladan dyabèt ak tansyon wo yo konplike varyab7.

D-gal yo panse pou jenere anomali byochimik ki sanble ak sa yo wè nan sèvo imen an ki aje, tankou aktivite redwi nan anzim antioksidan ak diminisyon newòn kolinerjik yo. Pwodui fen glikasyon avanse, ki lye nan tou de aje nòmal ak fizyopatoloji anpil maladi, yo pwodui pa entèraksyon D-gal ak gwoup amine pwoteyin. Bèt yo bay D-gal te lakòz neroenflamasyon, domaj mitokondriyo, ak domaj oksidatif nan devlopman espès oksijèn reyaktif (ROS) ansanm ak pwoblèm nan abitye nouvote, defisyans nan aprantisaj espasyal, ak fonksyon mantal8.

Enflamasyon ta ka yon faktè kle nan deteryorasyon mantal nan mitan granmoun aje yo. Nivo segondè nan interleukin-6, IL{-1, faktè necrosis timè-, ak pwoteyin C-reyaktif yo te lye nan yon risk ogmante nan morbidite ak mòtalite nan granmoun aje9. Tretman d-galaktoz kwonik nan rat pwovoke deklanchman siyal apoptotik newòn ak neroenflamasyon nan cortical serebral la ak ipokanp1.

Aje rezilta nan yon bès nan faktè nerotwofik ki sòti nan sèvo (BDNF) ki se yon pwoteyin enpòtan ki angaje nan chanjman plastik ki asosye ak aprantisaj ak memwa kòm byen ke yon medyatè enpòtan anpil pou pwopagasyon newòn ak entegrite10.

Dekouvèt nouvo konpoze ki retade aje ak sipòte pèfòmans kognitif vin youn nan pi gwo defi yo. Metformin byen vit penetre baryè san-sèvo a epi li devlope nan plizyè zòn nan sèvo, tankou glann pitwitè ak ipokanp11. Li te demontre ke administrasyon metformin alontèm diminye aparisyon konplikasyon patolojik ki gen rapò ak laj ak pwolonje lonjevite nan imen12. Anplis de sa, yo te montre metformin amelyore defisyans mantal ak twoub konpòtman tankou enkyetid nan tou de moun dyabetik ak moun ki pa dyabetik13,14 ak pasyan ki gen maladi neurodegenerative15. Sepandan, mekanis ki kache nan efè metformin nan amelyore andikap nerokognitif ki gen rapò ak laj yo konplike epi men yo pa totalman konprann.

Efè neropwotektif metformin ka prensipalman atribiye a deklanchman AMP-Activated Protein Kinase (AMPK) siyal chemen an. Aktivasyon AMPK kontwole ekspresyon BDNF, ki gen yon wòl enpòtan nan transmisyon sinaptik ak konsolidasyon memwa. Anplis de sa a pwopriyete byen etabli nan aktivasyon AMPK, rezilta anvan yo te demontre ke metformin ka amelyore memwa nan restorasyon nan estrès oksidatif, dekresyon nan neroenflamasyon, ak anpèchman nan apoptoz, ki ka elaji endikasyon klinik li yo nan zòn nan nan maladi neurodegenerative14. Metformin se yon activateur fò nan chemen fosfatidilinositol 3-kinaz/pwoteyin kinaz B (PI3K/Akt) ki se yon chemen siyal enpòtan enpòtan nan anpeche apoptoz ak ankouraje siviv selil16.

Lè w pran an konsiderasyon benefis metformin, ki gen ladan sekirite li, abòdab, ak itilizasyon; nou etidye efè neuroprotective administrasyon metformin kont andikap nerokognitif ki te koze pa aje d-galaktoz nan rat. Anplis de sa, yo te envestige mekanis molekilè ki kache nan efè pwoteksyon sa yo.

Materyèl ak metòd

Bèt.Tirty Wister albinos rat gason ki peze 200-250 gram yo te itilize nan eksperyans la apre yo fin jwenn apwobasyon ki nesesè nan Komite Etik Rechèch la nan Fakilte Medsin, Menoufa University, peyi Lejip (enskripsyon No 10/2022 PHYS 9). Pwosedi eksperimantal yo te swiv direktiv ARRIVE. Rat yo te loje nan kaj may fil (80 × 40 × 30 cm). Yo te bay tout bèt yo aksè konplè a manje ak dlo pandan peryòd etid la apre yo fin kondisyone yo pou 2 semèn nan kondisyon anviwònman konstan ak yon sik limyè/fènwa 12:12-h.

Konsepsyon eksperimantal.Bèt yo te divize owaza nan twa gwoup (10/gwoup):

1. Gwoup kontwòl: Resevwa solisyon saline atravè gavaj oral.

2. Gwoup d-galaktoz (D-gal): D-galaktoz te resevwa (Sigma-Aldrich St. Louis, USA) fonn nan yon solisyon saline nan yon dòz 100 mg/kg pwa kò atravè lavaj gastric pandan uit semèn youn apre lòt17.

3. D-galaktoz plis metformin (D-gal plis Met) gwoup trete: Resevwa d-galaktoz (pa menm dòz la nan gwoup D-gal) plis metformin (Sigma-Aldrich St. Louis, USA) fonn nan yon solisyon saline. nan yon dòz 200 mg/kg/jou atravè lavaj gastric pandan uit semèn youn apre lòt16

Apre fini uit semèn yo, yo te fè yon evalyasyon nero-konpòtmantal nan tout rat. Apre sa, rat yo te anestezi ak sakrifye pa elongasyon nan matris ak dislokasyon. Te sèvo a ekstrè epi lave ak salin tanpon fosfat (pH 7.4). Emisfè gòch la te peze epi divize an de mwatye; youn nan yo te itilize pou analiz byochimik ak lòt mwatye a te itilize pou etid RT-PCR. Emisfè dwat la te fikse nan yon saline fòmalin 10 pousan pou evalyasyon istopatolojik ak imunohistochimik nan tisi ipokanp yo.

Tès newokonpòtmantal.Nouvo rekonesans objè. Tès rekonesans objè roman yo te itilize pou evalye kapasite rat yo pou rekonèt yon nouvo objè nan yon anviwònman abitye. Chak rat te gen twa jou nan tès, ki enkli twa faz: abitye, fòmasyon, ak tès. Rat yo te mete nan yon aparèy jaden ouvè (50 cm × 50 cm × 40 cm) pandan faz abitye a, epi yo te ba yo dis minit pou adaptasyon san okenn atik. Chak rat te kenbe nan yon chanm ak de objè ki idantik pou senk minit pandan faz fòmasyon an. Apre vennkat èdtan, yo te mete chak rat nan chanm lan pou senk minit pandan faz tès la, ki te enplike ranplasman youn nan ansyen objè yo ak yon nouvo. Chronomèt la te itilize pou tan dire eksplorasyon objè a. Endèks diskriminasyon [=(tan eksplorasyon objè nouvo–tan eksplorasyon objè familyal)/tan eksplorasyon total × 100 pousan ] yo itilize pou evalye pèfòmans mantal rat yo. Yo te itilize alkòl pou netwaye jaden an louvri ak objè ki genyen ant rat18.

Labirent dlo Morris la. Labirent dlo Morris te itilize pou egzamine enpak metformin sou aprantisaj espasyal ak memwa. Yon pisin te fè nan asye pur, te gen yon dyamèt 210 cm ak yon wotè 50 cm ki gen ladan yon platfòm chape anba submerged 1 cm anba sifas dlo a. Dlo a te kenbe nan 24±1 degre. Travay akizisyon an te teste sou senk jou tès ak kat esè chak jou. Tan ki nesesè pou ale nan platfòm sekrè a pandan chak jijman te anrejistre kòm latansi chape. Yon maksimòm de 60 segonn te bay rat yo pou yo lokalize platfòm kache a. Yo te bay yon limit tan maksimòm de 60 s, epi yo te gide rat la manyèlman nan platfòm la kache. Yon sèl jijman ankèt te fèt 24 èdtan apre dènye jijman an nan senkyèm jou a. Yo te retire platfòm la epi yo te mete rat la nan pisin lan soti nan kadran an opoze ak kadran fòmasyon an. Lè sa a, yo te pèmèt rat la naje lib pou 60 s. Tan ki pase nan kadran sib la te anrejistre19.

Egzamen an plis labirent (EPM). EPM se yon teknik etabli pou evalye konpòtman ki tankou enkyetid nan rat. Li te fèt an bwa epi li te fèt nan bra louvri ak fèmen (50 cm nan longè × 10 cm nan lajè). De bra fèmen yo te fèmen pa mi 40 cm wotè. Bra yo te tache pa yon platfòm kare santral (10 × 10 cm). Aparèy la te 50 cm anwo etaj la. Yo te mete chak rat nan sant aparèy la anfas yon bra fèmen epi yo te pèmèt yo deplase lib pou senk minit. Tan an te pase nan bra yo louvri ak fèmen yo te anrejistre. Epitou, antre louvri bra yo te anrejistre nan 20. Nou menm tou nou mezire Latansi Transfè (TL) ki itilize pou evalye memwa ak aprantisaj. Nan premye jou a (sesyon akizisyon an), chak rat te ekspoze a EPM pou 90 s. Tan rat la pran pou rive nan bra fèmen an te anrejistre kòm TL la. Rat ki echwe pou antre nan bra fèmen nan 90 s yo te eskli nan etid la. Nan dezyèm jou a (sesyon retansyon an), yo te mete chak rat nan bra a louvri, epi TL la te anrejistre pou yon maksimòm de 90 s21.

Analiz byochimik.Tisi nan sèvo yo te perfused ak solisyon PBS, Lè sa a, omojeneize nan yon tanpon frèt 5 ml pou chak tisi gram. Santrifugasyon tisi nan sèvo a te fè nan 4000 rpm pou 15 minit, Lè sa a, supernatant la te retire epi estoke nan -80 degre jiskaske mezi Malondialdehyde (MDA) ak Superoxide Dismutase (SOD) lè l sèvi avèk kolorimetri konvansyonèl yo (QuantiChrom™, BioAssay Systems, USA), serik Timè Necrosis Factor (TNF-), Interleukin 10 (IL-10), ak Brain-Derived Neurotropic Factor (BDNF) lè l sèvi avèk ELISA twous (Quantikine, konpayi Abcam, Cambridge, UK) dapre manifakti a. enstriksyon yo.

Egzamen kantitatif ekspresyon jèn AMPK ak PI3K lè l sèvi avèk teknik reyaksyon chèn polymerase transcriptase ranvèse (RT-PCR).Tisi nan sèvo yo te prepare pou izolasyon total RNA lè l sèvi avèk Qiagen RN Easy plus Universal Kit soti nan USA. Lè sa a, bon jan kalite RNA ak pite yo te asire. RNA te estoke nan - 80 degre jiskaske yo itilize. Lè sa a, premye etap la se cDNA sentèz lè l sèvi avèk QuantiTect Reverse Transcription Kit, Qiagen soti nan USA a, lè l sèvi avèk Applied Biosystems 2720 tèmik sikilasyon (Singapore) pou yon sèl sik. Jadendanfan GAPDH yo te itilize nan reyaksyon RT-PCR kòm yon kontwòl chaj RNA. Dezyèm etap la se anplifikasyon cDNA: cDNA te itilize nan SYBR ki baze sou vèt PCR quantitative an tan reyèl pou Quantification Relatif (RQ) nan ekspresyon jèn AMPK ak PI3K pa SensiFASTTMSYBR Lo-ROX Kit, USA, lè l sèvi avèk primè sa yo ki fèt (Midland, Texas). ): Te pi devan Jadendanfan pou AMPK te (TGCGTGTACGAAGGAAGAATCC). Ak Jadendanfan ranvèse a te (TGTGACTTCCAGGTCGGAGTT). Jadendanfan an pi devan pou PI3K te (AGCTGGTCTTCGTTTCCTGA), ak Jadendanfan ranvèse a te (GAAACTTTTTCCCACCACGA). Finalman, analiz done ak Applied Biosystems 7500 lojisyèl vèsyon 2.0.1 te fè. RQ ekspresyon jèn AMPK ak PI3K te fèt lè l sèvi avèk yon metòd konparatif ∆∆Ct, kote kantite mRNA sib yo (AMPK ak PI3K) nòmalize nan yon jèn referans andojèn (GAPDH) ak relatif nan yon kontwòl.

Evalyasyon istopatolojik nan tisi nan sèvo.Egzamen histolojik. Tisi nan sèvo yo te fiks nan yon solisyon fòmalin 10 pousan, entegre nan parafine, epi yo te jwenn seksyon koronèl seri 5 μm epesè. Lè sa a, seksyon nan ipokanp nan sèvo yo te tache ak Ematoksilin ak Eosin (H&E) pou egzamen an ak yon mikwoskòp limyè.

Tach imunohistochimik nan ipokanp la. Tach imunohistochimik nan kaspas -3 (nimewo CAT: ab32351, konpayi Abcam 152 Grove Street Waltham, M02453, USA) ak sinaptofizin (nimewo CAT: ab32127, konpayi Abcam 152 Grove Street Waltham, M02453, USA) te fèt lè l sèvi avèk lapen. antikò monoklonal. Pou Bcl-2 (nimewo CAT: ab59348, konpayi Abcam 152 Grove Street Waltham, M02453, USA), li te fèt lè l sèvi avèk antikò poliklonal lapen. Yo te resevwa nan yon sèl flakon ki gen 1 ml antikò. Anti-caspase-3, anti-synaptophysin, ak anti-Bcl-2 yo te itilize nan kantite dilye 1:50, 1:400, ak 1:100 respektivman. Seksyon yo te koupe nan 5 µm ak tache pa yon LINK 48 imunostainer otomatik (Dako, Agilent Technologies Inc, Santa Clara, USA). Pou rekipere chalè, immunostainer te itilize tanpon citrate. Glisad yo te tache otomatikman pa antikò prensipal dilye. Kontwòl pozitif pou reyaksyon an te fèt lè l sèvi avèk seksyon espesifik nan parafine nan amidal nòmal imen an, pankreyas imen, ak adenom folikulèr pou caspase-3, sinaptofizin, ak Bcl-2, respektivman. Kontwòl negatif yo te fè pa ranplase antikò prensipal yo ak serom ki pa iminitè.

Yo te fè evalyasyon istopatoloji ak makè imunohistochimik (caspase-3, sinaptofizin, ak Bcl-2) nan diferan zòn nan ipokanp la ki gen ladan CA1, CA2, ak CA3.

Analiz estatistik.Rezilta yo eksprime kòm mwayen ± Devyasyon Estanda (SD). Analiz divèjans (ANOVA) yo te itilize pou analiz estatistik diferan gwoup yo, lè l sèvi avèk lojisyèl Orijin® ak pwobabilite pou chans (valè p). Valè P<0.05 were considered significant.

Apwobasyon etik ak konsantman pou patisipe.Travay sa a te apwouve pa ak pa direktiv yo nan Komite Etik la nan Fakilte Medsin, Menoufa University, peyi Lejip.

Rezilta yo

Tès newokonpòtmantal.Konsènan tès objè roman an, pousantaj endèks diskriminasyon an te siyifikativman pi ba nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la (-37.16±3.31 pousan kont 30.16±2.92 pousan, respektivman, P<0.05). The percentage of discrimination index was significantly higher in the D-gal+Met group  (16.66±4.67%, P<0.05) when compared with the D-gal group. However, this percentage is still significantly lower when compared with the control group (Fig. 1).

Konsènan tès labirent Morris, valè an mwayèn nan dire latansi chape te siyifikativman pi wo nan premye, dezyèm, twazyèm, katriyèm, ak senkyèm jou nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la (58.16±1.94, 4{). {19}}.62±1.33, 32.75±1.10, 24.37±1.58, ak 15.29±0.98 s kont 40.16±2.92, 25.16±1.15, 17.04±1.08, ak 18.04±1.08, ± 1.831.7, ± 1.0. 86 s, respektivman, P<0.05). The means value of the duration of escape latency was significantly lower in the D-gal+Met group in the five training days (50±1.41, 34.08±1.15, 25.16±1.31, 16.04±1.75,   and 10.25±1.01 s, respectively, P<0.05) when compared with the D-gal group. However, the mean values of the durations of escape latency in the five training days in the D-gal+Met group were still significantly higher when compared with the control group. The means value of the duration that the rats spent in the target quadrant were significantly lower in the D-gal group when compared with the control group (12.50±1.87 vs. 23.50±1.87 s,   respectively, P < 0.05). However, the mean value of the duration that the rat spent in the target quadrant was significantly higher in the D-gal+Met group (19.66 ± 2.16 s, P < 0.05) when compared with the D-gal group.  However, its level is still significantly lower when compared with the control group (Fig. 2).

Nan tès la plis-labirent elve, valè mwayèn nan dire rat yo te pase nan bra yo louvri te siyifikativman pi ba nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la (60±6.54 s kont 90.83±3.48 s, respektivman. , P<0.05). On the other hand, the mean value of the duration that the rats spent in the open arms was significantly higher in the D-gal+Met group (73.83±5.41 s, P < 0.05) when compared with the D-gal group. However, its level was still significantly lower when compared with the control group. On the contrary, the mean value of the duration that the rats spent in the closed arms was significantly higher in the D-gal group when compared with the control group (107.33±3.07 s vs. 57.66±5.12 s respectively, P<0.05). The means value of the duration that the rats spent in the closed arms were significantly lower in the D-gal+Met group (74.66±2.58 s, P<0.05)   when compared with the D-gal group. However, its level was still significantly higher when compared with the control group. The mean value of the number of open-arm entries was significantly lower in the D-gal group when compared with the control group (12.50±1.87 vs. 32.33±3.07, respectively, P<0.05). On the contrary, the mean value of the number of open-arm entries was significantly higher in the D-gal+Met group (21.66±2.16,  P<0.05) when compared with the D-gal group. However, its level is still significantly lower when compared with the control group. The mean value of the duration of the transfer latency was significantly higher in the D-gal group when compared with the control group (48.33 ±6.88 s vs. 25 ±1.87 s, respectively, P < 0.05). While the mean value of the duration of the transfer latency was significantly lower in the D-gal+Met group (34.66±3.77 s,  P<0.05) when compared with the D-gal group. However, its level was still significantly higher when compared with the control group (Fig. 3).

Tès byochimik.Valè an mwayèn nan nivo MDA nan sèvo te siyifikativman pi wo, pandan y ap valè an mwayèn nan nivo SOD nan sèvo te siyifikativman pi ba nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la (70±3.23 nmol/mg pwoteyin ak 13.05±1.{{7}). }} U/mg pwoteyin vs 33.76±2.13 nmol/mg pwoteyin ak 29.11±4.34 U/mg pwoteyin respektivman, P<0.05). The mean value of brain MDA level was significantly lower, while the mean value of brain SOD level was significantly higher in the D-gal+Met group (50.02±4.26 nmol/mg protein and  21.90±2.33 U/mg protein, respectively, P<0.05) when compared with the D-gal group. However, the mean value of MDA is still significantly higher, and the mean value of SOD is significantly lower when compared with the control group (Fig. 4a,b).

Valè an mwayèn nan nivo TNF nan sèvo a te siyifikativman pi wo, pandan y ap valè mwayèn nan nivo IL-10 nan sèvo a te siyifikativman pi ba nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la (67.50 ± 10.03 pg/mg pwoteyin ak 72.91). ±8.45 pg/mg pwoteyin kont 16.61 ±1.21 pg/mg pwoteyin ak 157.23 ±12.46 pg/mg pwoteyin, respektivman, P<0.05). The mean value of brain TNF-α level was significantly lower, while the mean value of brain IL-10 level was significantly higher in the D-gal+Met group (49.83±1.89 pg/mg protein and 131.67±4.54 pg/mg protein,   respectively, P<0.05) when compared with the D-gal group. But, the mean value of TNF-α was still significantly higher, and the mean value of IL-10 was significantly lower when compared with the control group (Fig. 4c,d).

Valè an mwayèn nan nivo BDNF nan sèvo te siyifikativman pi ba nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la (125.72±4.17 pg/mg pwoteyin kont 225.20±5.52 pg/mg pwoteyin, respektivman, P<0.05). The mean value of brain BDNF level was significantly higher in the D-gal +Met group (215.03±3.65 pg/mg protein, P < 0.05)   when compared with the D-gal group. However, its level is still significantly lower when compared with the control group (Fig. 5).

Kantitatif RT-PCR (qRT-PCR). Ekspresyon jèn AMPK ak PI3k (0.52±0.11ak 0.37±0.03, respektivman, P<0.05) was significantly down-regulated in the D-gal group when compared with the control group (1). However, the expression of AMPK and PI3k genes was significantly up-regulated in the  D-gal+Met group (0.95±0.08 and 0.98±0.04, respectively, P<0.05), when compared with the D-gal group, but it was insignificantly changed (P>0.05) lè yo konpare ak gwoup kontwòl la (figi 6).

Istopatoloji.Tach H & E nan tisi ipokanp nan gwoup kontwòl la te revele chanjman patolojik san remakab. Gwoup D-gal la te montre anpil koripsyon newòn ak kò apoptotik ak èdèm masiv ak glioz. Sepandan, seksyon gwoup D-gal plis Met yo te montre kèk dejenerasyon newòn ak kèk kò apoptotik ki gen ti èdèm ak ti gliyoz fokal (figi 7).

Imunohistochimi. Rezilta imunohistochimik yo te revele ke valè nòt H nan ekspresyon sinaptofizin nan tisi ipokanp yo te siyifikativman pi ba (P<0.05) in the D-gal group when compared with the control group (100±5.78 vs. 260±4.03). However, the expression of synaptophysin (180±5.26) in hippocampal tissue in the D-gal+Met group was significantly higher when compared with the D-gal group. However, it was still significantly lower when compared with the control group (Fig. 8).

Valè nòt H nan ekspresyon kaspas-3 nan tisi ipokanp yo te siyifikativman pi wo (P<0.05) in the  D-gal group when compared with the control group (279±5.35 vs. 89±3.54). On the other hand, the H score value of the caspase-3 expression in hippocampal tissue in the D-gal+Met group (151±4.73) was significantly lower when compared with the D-gal group, but still significantly higher when compared with the control group  (Fig. 9). 

Valè nòt H nan ekspresyon Bcl-2 nan tisi ipokanp yo te siyifikativman pi ba (P<0.05) in the D-gal group when compared with the control group (161±4.36 vs. 301±6.11). While the H score value of Bcl-2 expression in hippocampal tissue in the D-gal+Met group (179±7.48) was significantly higher when compared with the D-gal group, it was still significantly lower when compared with the control group (Fig. 10).

Diskisyon

Ogmantasyon nan esperans lavi mwayèn ogmante risk pou yo maladi nan granmoun aje yo, espesyalman nan tèren an mantal ki ta ka, omwen an pati, akòz pèt newòn nan sèvo a. Li se byen aksepte ke piki a alontèm nan d-galaktoz kontribye nan pwogrè aje ak ti domaj newòn ak domaj memwa. Depi aje D-galinduced akonpaye pa neurodegeneration, li ta ka yon modèl ideyal pou etidye mekanis molekilè ki enplike nan neurodegeneration laj ki asosye ak pou teste nouvo apwòch terapetik22.

Etid nou an te montre ke administrasyon kwonik D-gal gen pwoblèm konpòtman eksplorasyon kado-pwovoke ak memwa k ap travay nan rat. Sa a te evidan nan rezilta yo nan objè a roman, Morris dlo labirent, ak elve plis tès labirent. Rezilta sa yo te nan liy ak lòt etid rapòte23. Nan lòt men an; tretman ak metformin amelyore memwa travay la ak preferans pou kado lè yo konpare ak gwoup D-gal la. Sipòte rezilta nou yo, yon etid anvan te rapòte ke metformin amelyore memwa a kout tèm nan sourit dyabetik strèptozotocin-induit24. Li byen dokimante ke aje asosye pa sèlman ak yon bès nan fonksyon mantal, men tou ak chanjman emosyonèl ki gen ladan konpòtman ki sanble ak enkyetid ki lakòz andikap fonksyonèl25. Nan etid prezan an, rezilta tès EPM yo te montre yon konpòtman ki sanble ak enkyetid nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la. Pandan ke tretman ak metformin diminye konpòtman ki tankou enkyetid.

Etid la te revele ke chanjman nero-konpòtmantal ki te koze pa administrasyon oral D-gal te akonpaye pa latwoublay nan makè estrès oksidatif nan sèvo. Valè an mwayèn nan nivo MDA nan omojene tisi nan sèvo te siyifikativman pi wo, pandan y ap aktivite a nan anzim antioksidan SOD la te siyifikativman pi ba nan gwoup D-gal la lè yo konpare ak gwoup kontwòl la. Rezilta menm jan an te deja rapòte 23,26. D-gal reyaji ak divès kalite amine gratis nan achitekti pwoteyin atravè glikasyon ki pa anzimatik, sa ki lakòz jenerasyon pwodwi glikasyon avanse. Sa a lakòz jenerasyon ROS ki ogmante aje nan sèvo atravè domaj oksidatif nan ADN, lipid, ak pwoteyin. Pèt memwa ak andikap aprantisaj pwovoke pa administrasyon kwonik nan D-gal ta ka atribiye a jenerasyon an nan radikal gratis, sa ki lakòz andikap nan nerojenèz ak, finalman, neurodegeneration27. Anplis, newòn nan sèvo yo gen plis sansib a estrès oksidatif akòz prezans nan kontni segondè lipid ak pi wo konsomasyon oksijèn26.

Okontrè, administrasyon metformin siyifikativman retabli balans redox la. Prèv yo montre ke metformin ka anpeche Mitokondriyo Perméabilité Tranzisyon Pore (mPTP) epi redwi pwodiksyon ROS ak peroksidasyon lipid28. Se poutèt sa, sa a endike ke efè anti-aje metformin ta ka pètèt medyatè pa defans antioksidatif li yo.

Anplis estrès oksidatif, enflamasyon tou se yon mekanis enpòtan aje-pwovoke nan tretman D-gal. D-gal ankouraje jenerasyon ROS ki aktive chemen enflamatwa3. Neuroenflamasyon kwonik ak sekresyon sitokin pro-enflamatwa se karakteristik aje29. Gen yon akò ke sitokin enflamatwa yo patisipe nan estrès oksidatif. TNF-, IL-6, ak IL-1 esansyèl nan devlopman ak pwogresyon estrès oksidatif. Sitokin sa yo asosye ak ROS epi aktive Nuclear factor-κB (NF-κB) pou transloke nan nwayo a epi kontwole ekspresyon jèn pro-enflamatwa tankou iNOS ak COX2, ki enplike nan repons enflamatwa ak iminitè, epi kidonk mennen nan. fibwoz, apoptoz, ak repons faz egi ki lakòz domaj nan ògàn30. Done yo mansyone pi wo a te konsistan avèk rezilta nou yo, kòm nivo TNF-alfa te siyifikativman pi wo, ak IL-10 te siyifikativman pi ba nan gwoup D-gal la konpare ak gwoup kontwòl la.

Nan lòt men an, tretman ak metformin te lakòz yon rediksyon enpòtan nan makè enflamatwa yo lè yo konpare ak gwoup D-gal la. Efè anti-enflamatwa metformin ta ka atribiye a aktivasyon siyal AMPK, ki siprime reyaksyon enflamatwa atravè anpèchman NF-κB29. Epitou, li diminye pwodiksyon pro-enflamatwa sitokin ak aktivasyon mikroglial nan sèvo a ki, nan vire, diminye estrès oksidatif30.

Pou plis konprann mekanis molekilè ki kache aksyon metformin, nou egzamine ekspresyon pwoteyin AMPK ak PI3k. Etid nou an te revele ke ekspresyon AMPK te siyifikativman desann-reglemante nan gwoup la D-gal lè yo konpare ak gwoup la kontwòl, pandan y ap nivo li yo te siyifikativman moute-reglemante nan gwoup la metformin-trete lè yo konpare ak gwoup la D-gal. Etid anvan yo te rapòte ke deklanchman AMPK ak repons AMPK diminye ak laj, sa ki ka eksplike règleman metabolik ki chanje, sa ki lakòz otofaji redwi ak yon ogmantasyon nan estrès oksidatif31. Metformin yo te jwenn aktive AMPK nan ogmante fosforilasyon AMPK nan Tr-17232. AMPK se sib prensipal metformin pou fonksyon pwoteksyon li kont dezòd koyisyon. Ghadernezhad et al. rapòte ke metformin-pwovoke deklanchman nan AMPK te mennen nan aktivasyon an nan chemen BDNF/P70S6K nan newòn ipokanp yo amelyore fòmasyon nan memwa nan travay evite pasif nan yon serebral serebral rat ischemi/reperfusion. Aktivasyon BDNF gen yon wòl enpòtan anpil nan règleman fonksyon nerokognitif tankou aprantisaj, memwa, transmisyon sinaptik, ak plastisit 33. Plizyè etid te demontre ke AMPK te kapab aji kòm yon modulateur nan Potansyasyon alontèm (LTP), epi li nesesè pou fòmasyon memwa34. . Se poutèt sa, amelyorasyon memwa pwovoke metformin nan etid nou an ta ka medyatè atravè aktivasyon siyal AMPK.

【Pou plis enfòmasyon: david.deng@wecistanche.com / WhatApp:86 13632399501】