Naringin ak Hesperidin kontrekare epatotoksisite diclofenac-induit nan gason Wistar rat atravè antioksidan yo, anti-enflamatwa, ak aktivite antiapoptotik Pati 1.
Mar 24, 2022
Tanpri kontakteoscar.xiao@wecistanche.compou plis enfòmasyon
1. Entwodiksyon
Medikaman anti-enflamatwa ki pa esteroyid (AINS) gen plizyè efè segondè [1]. Diclofenac, kòm youn nan kategori sa a nan dwòg, se yon derive asid fenilasetik ki depi lontan te itilize kòm yon analgesic ak yon dwòg anti-enflamatwa nan trete sèten kondisyon [2].Nan mekanis li yo nan aksyon, diclofenac inibit cyclooxygenase-(COX-). )2 anzim ki gen pi gwo puisans pase li aji sou COX-1 [3]. Malgre ke diclofenac gen efè terapetik ki pisan, itilizasyon dirab li asosye ak efè negatif ki depann de dòz grav [3]. Yon ogmantasyon nanoksidatifestrès ak repwesyon nan sistèm defans antioksidan te rapòte pa plizyè piblikasyon ki te enplike nan endiksyon an nan toksisite ak efè segondè nan dwòg la [4,5]. Itilizasyon antioksidan tankou flavonoid Citrus nan konbinezon ak diclofenac ka kontrekare estrès oksidatif diclofenac-induit epi kidonk ka anpeche efè segondè dwòg ak toksisite.

Tanpri klike la a pou w konnen plis
Naringin responsab pou gou tounen ak gou anmè nan fwi yo nan espès Citrus gen gwo spectre farmakolojik ak pwopriyete terapetik tankou bese lipid, anti-enflamatwa, gratis radikal-scavenging, antioksidatif, antihyperlipidemic,
pwopriyete antiapoptotik, ak antiaterojenik [6,7. Hesperidin se yon lòt flavonoid izole nan espès Citrus ki te gen plizyè pwopriyete byolojik, patikilyèman antioksidan ak anti-enflamatwa [8]. Yo te rapòte ke hesperidin amelyore blesi nan tisi fwa cytochrome-induit obsève paistopatolojikegzamen [9]. Li te tou revele ke hesperidin te efikas nan siprimeenflamasyonak sentòm alèjik ak nan tretman rinit alèjik [10]. Se poutèt sa, etid sa a te fèt pou evalye posib efè prevantif naringin ak hesperidin sou toksisite fwa diclofenac-induit ak eksplore wòl modulation nan enflamasyon, estrès oksidatif, ak apoptoz nan aksyon prevantif la.
2. Materyèl ak Metòd
2.1. Pwodwi chimik ak twous. Diclofenac sodyòm te jwenn nan El-Nasr Pharmaceutical Chemical Company, peyi Lejip.
Naringin ak hesperidin te pwodwi pa Sigma-Aldrich Konpayi (St. Louis, MO, USA). Tout lòt pwodwi chimik yo itilize yo se nan klas analyse epi yo te jwenn nan konpayi chimik lokal yo. Alanine transaminase (ALT) ak aspartate trans-aminase (AST) twous yo te jwenn nan Spinreact, Ctra Sta Coloma, 7.17176 St., Esteve de Bas, Girona, Espay. Lactate dehydrogenase (LDH) ak y-glutamyltransferase (GGT) yo te jwenn nan Spectrum, konpayi moun peyi Lejip pou Biotechnologie, Obour City Industrial Area, Cairo, peyi Lejip. Twous fosfataz alkalin (ALP) te jwenn nan Biodiagnostic, 29 Tahrir St., Dokki, Giza, peyi Lejip. Yo te jwenn twous albumin ak bilirubin nan Diamond,24 El Mon-matzah St., Heliopolis, Cairo, peyi Lejip.

Cistanche ka amelyore iminite
2.2.Bèt eksperimantal. Yo te itilize rat gason adilt souch Wistar ki te peze 100-130g (9-1l semèn) kòm bèt eksperimantal nan travay prezan an.
Yo te jwenn nan Ani-mal House of Ophthalmology Research Institute, Giza, peyi Lejip. Bèt yo te loje nan kaj byen aere nan 12 èdtan chak jou nan sik limyè-fè nwa ak tanperati ant 20 ak 25 degre. Rat yo te konplete chak jou ak yon rejim granules estanda ak dlo ad libitum. Bèt yo te kenbe pou de semèn anba obsèvasyon anvan yo kòmanse eksperyans la pou adaptasyon ak eskli nenpòt enfeksyon entèkouran. Tout metodoloji bèt yo an akò ak direktiv yo ak enstriksyon yo nan Komite Etik bèt eksperimantal nan Fakilte Syans pou Swen ak Itilizasyon Bèt yo, Beni Suef University, peyi Lejip. Nimewo apwobasyon etik la se BSU/FS/2015/15. Tout efò yo te fè pou redwi soufrans ak detrès bèt yo.
2.3.Gwoupman bèt. Yo te itilize trant gason rat Wistar nan eksperyans sa a epi yo te asiyen nan senk gwoup (Figi 1).
Rat yo nan gwoup 1 (nòmal) te resevwa volim ekivalan nan saline (veyikil kote diclofenac te dis-soude) pa piki entraperitoneal epi tou li te bay volim ekivalan a 1 pousan.karboksimetilseluloz (CMC; veyikil kote naringin ak hesperidin te fonn) pa gavaj oral chak jou pandan 4 semèn. Gwoup 2 (diclofenac-enjekte gwoup) te sou fòm piki ak diclofenac (fonn nan saline) pa administrasyon intraperitoneal nan yon dòz 3 mg / kilogram pwa kò (kgb. wt) / jou [11] epi yo te tou bay volim nan ekivalan a 1 pousan. CMCby oral gavage chak jou pou 4 semèn. Gwoup 3 (diclofenac-enjekte gwoup trete ak naringin) te bay diclofenac tankou nan gwoup 2 epi yo te trete oralman ak naringin (fonn nan 1 pousan CMC) nan yon nivo dòz 20mg / kgb. wt/jou pa gavaj oral [12] pou 4 semèn. Gwoup 4 (diclofenac-enjekte gwoup trete ak hesperidin) te bay diclofenac tankou nan gwoup 2 epi yo te trete oralman ak hesperidin (dis-rezoud nan 1 pousan CMC) nan yon dòz 20mg / kg b.wt / jou [13] pou 4. semèn. Gwoup 5 (gwoup diclofenac-enjekte trete ak naringin ak hesperidin) te konplete ak diclofenac tankou nan gwoup 2 epi yo te trete oralman ak naringin akesperidin(fonn nan 1 pousan CMC) nan yon dòz 20mg/kg b. wt / jou pou 4 semèn.
2.4.Echantiyon san ak fwa.
Nan fen eksperyans la, rat yo te prive de manje, epi yo te kolekte echantiyon san nan venn jugulaire yo. Echantiyon san yo te kite koagulasyon nan tanperati chanm ak Lè sa a, santrifuje nan 3000rpm pou 15 minit. Serom chak echantiyon san yo te divize an twa flakon ki te kenbe nan -30 degre jiskaske yo te itilize pou analiz byochimik.
Apre yo fin pran echantiyon san nan venn jugulaire a, yo te retire rat yo epi yo te diseke. Fwa chak rat yo te retire rapidman epi lave nan saline esteril ({{0}}.9 pousan NaCl. Yo te fikse moso nan fwa a nan 10 pousan fòmalin tanpon net pou envestigasyon histolojik. Lòt pati yo te kenbe nan yon ti kras. gwo twou san fon frizè nan -30 degre annatant omojènize nan saline esteril izotonik (0.9 pousan NaCl) pou detèminasyon estrès oksidatif ak makè defans antioksidan. Yo te kenbe twazyèm pati fwa a nan -30 degre nan tib Eppendorf esteril pou analiz ranvèse transkriptaz-polymerase chèn reyaksyon (RT-PCR).
2.5. Deteksyon paramèt fonksyon fwa nan serom.
Aktivite ALT ak AST yo te estime lè l sèvi avèk metòd oksidasyon nikotinamid adenine dinukleotide idwojèn (NADH) dapre metòd Murray [14] ak Murray [15], respektivman, lè l sèvi avèk twous reyaktif achte nan Spinreact, Espay. An brèf, ALT katalize konvèsyon alanin nan Pyruvate, ki redwi a laktat pa LDH, ak NADH soksid nan nikotinamid adenine dinucleotide (NAD). Pousantaj nan diminisyon nan konsantrasyon NADH, mezire fotometrik nan 340nm, se pwopòsyonèl ak konsantrasyon katalitik nan ALT prezan nan echantiyon an serik. Nan lòt men an, AST katalize konvèsyon nan aspartate nan oksaloacetat, ki se redwi a malat pa malat dehydrogenase (MDH), ak NADH se soksid nan NAD. Pousantaj nan diminisyon nan konsantrasyon NADH, mezire fotometrik nan 340nm, se pwopòsyonèl ak konsantrasyon katalitik nan AST prezan nan echantiyon an serik. Aktivite serik LDH te detekte dapre metòd Van der Heiden et al. [16]. Nan metòd sa a, LDH katalize reyaksyon ki genyen ant piruvat ak NADH pou pwodui NAD* ak L-laktat. Pousantaj nan diminisyon nan konsantrasyon NADH, mezire fotometrik nan 340 nm, se pwopòsyonèl ak konsantrasyon katalitik LDH prezan nan echantiyon an. Aktivite ALP serik yo te detèmine dapre metòd Belfield ak Goldberg [17] lè l sèvi avèk twous yo te jwenn nan Biodiagnostic, peyi Lejip. Lè w ajoute echantiyon serik nan fenil fosfat (5 mmol/L) nan pH 10,

ALP mennen nan fòmasyon nan fenol ak fosfat. Yo mezire fenol liberasyon an kolorimetrikman nan 510nm nan prezans 4-aminofenazon ak ferryyanide potasyòm. Aktivite GGT yo te detèmine dapre metòd Szasz ak Persijn [18] lè l sèvi avèk twous yo te jwenn nan Spectrum Diagnostic, Konpayi Ejipsyen pou Biotechnologie, peyi Lejip. GGT transfere yo-glutamilgroup nan substra L- -glutamil-p-nitroanilide, libere chromogen p-nitroanilide (PNA) ki mezire nan 418nm ak fòmasyon li se pwopòsyonèl ak aktivite GGT la. Nivo albumin serom te detèmine dapre metòd Doumas et al. [19] lè l sèvi avèk twous reyaktif achte nan Diamond, peyi Lejip. Metòd la, an brèf, te fèt lè w ajoute 10μL serom nan 2mL bro-plis sol green (0.12mmol/L) nan tanpon citrate pH 3.8. albumin/bromokresolkonplèks vèt, ki te fòme pa reyaksyon an, te mezire nan 630nm. Nivo bilirubin serik yo te teste dapre metòd Malloy ak Evelyn [20] lè l sèvi avèk twous reyaktif yo te achte nan Diamond, peyi Lejip. Metòd sa a pou estimasyon bilirubin baze sou reyaksyon van den Bergh. Nan reyaksyon sa a, bilirubin reyaji ak asid sulfanilik diazotized pou pwodui azobilirubin ki gen koulè wouj violèt epi li te mezire fotometrik nan 578nm. Entansite koulè a dirèkteman pwopòsyonèl ak kantite bilirubin nan serik la.
2.6. Evalyasyon estrès oksidatif fwa ak paramèt sistèm defans antioksidan.
Peroksidasyon lipid fwa (LPO) te detèmine dapre metòd Preuss et al. [21]. An brèf, pwoteyin nan te presipite lè w ajoute 0.15mL 76 pousan asid trichloroacetic (TCA) nan 1 mL omojene fwa. Apre sa, 0.35mL asid thiobarbituric (TBA) te ajoute, kòm yon ajan koulè-devlopman, nan supernatant ki separe a. Koulè woz ki devlope a te mezire nan 532nm apre enkubasyon nan yon beny dlo nan 80 degre pou 30 minit. MDA (malondialdehyde oswa 1,1,3,3-tetra methoxy propane) te itilize kòm estanda. Yo te detèmine kontni glutatyon (GSH) redwi nan fwa a lè yo ajoute 0.5 mL5,5'-dithiobis (2-asid nitwojèn-zoik), reyaktif Ellman a (kòm yon ajan ki devlope koulè), ak solisyon tanpon fosfat (pH 7). ) pou homogenate super-natant apre presipitasyon pwoteyin ki baze sou pwosedi Beutler et al. [22]. Koulè jòn devlope nan echantiyon ak estanda GSH yo te mezire nan 412nm kont vid. Aktivite GPx fwa te mezire selon pwosedi Matkovics et al.[23] ak kèk modifikasyon. Metòd sa a baze sou deteksyon GSH ki konvèti nan glutatyon oksidize (GSSG) pa anzim nan deteksyon GSH rezidyèl la epi soustraksyon li nan total la. Yon ti tan, yo te ajoute 50 μL omojèn supernatant nan yon tib Wasserman ki gen 350μL Tris tanpon (pH 7.6), 50μL solisyon GSH (2mM), ak 50μL H, O, (3.38mM). Lè sa a, apre 10 minit nan enkubasyon, yo te mezire kontni GSH rezidyèl la pa metòd ki dekri deja pou detèminasyon GSH nan 430nm. Tès estanda a te prepare lè yo ajoute 50μL dlo distile olye pou yo 50μL echantiyon ak tès vid la te prepare lè yo ajoute 100μL dlo distile olye pou yo 50μL echantiyon ak 50μL GSH solisyon. Apre deteksyon nan kontni GSH rezidyèl nan echantiyon an, GSH la konvèti nan fòm oksidize (GSSG) ak aktivite anzim yo ka kalkile. Aktivite superoksid dismutase (SOD) fwa te detekte dapre metòd Marklund ak Marklund [24]. Reyaksyon an baze sou anpèchman otooksidasyon pirogallol pa SOD. Pwosesis la depann de prezans iyon superoksid. Kantite anzim ki lakòz yon anpèchman 50 pousan nan chanjman yo disparisyon nan 1 minit konpare ak kontwòl la konsidere kòm yon inite nan anzim la.
2.7.Detèminasyon nivo serik TNF-, IL-17, ak IL-4.
Nivo serik TNF-, I-17, ak I-4 yo te estime dapre twous espesifik tès imunosorban lye ak anzim (ELISA) dapre enstriksyon manifakti a. Rat TNF-alpha ELISA kit (Katalòg No: MBS355371), IL-17 ELISA twous (Katalòg No.MBS5203506), ak IL-4 ELISA kit (Katalòg No: MBS494192) yo te jwenn nan MyBioSource, Inc. , San Diego, CA, Etazini. Kit ELISA sa yo sèvi ak ELISA sandwich. An brèf, mikwo ELISA plak yo bay nan twous sa yo te prekouch ak yon antikò espesifik nan sitokin konsène a. Yo ajoute estanda oswa echantiyon yo nan pwi plak mikwo ELISA ki apwopriye yo epi konbine avèk antikò espesifik yo. Lè sa a, yon antikò deteksyon biotinylated espesifik pou cytokine konsène a ak avidin-refor peroksidaz (HRP) konjige yo ajoute nan chak mikroplak byen siksesif epi enkube. Konpozan gratis yo lave lwen. Se solisyon an substra ajoute nan chak pi. Se sèlman pwi sa yo ki gen sitokin, antikò deteksyon biotinilate, ak konjige avidin-HRP ap parèt ble nan koulè. Reyaksyon anzim-substra a fini lè yo ajoute yon solisyon asid silfirik epi koulè a vin jòn. Dansite optik (OD) mezire spectrophotometrically nan yon longèdonn 450 nm. Valè OD a pwopòsyonèl ak konsantrasyon cytokine teste a epi konsantrasyon li nan echantiyon yo ka detèmine lè w konpare OD echantiyon yo ak koub estanda a.
2.8.Deteksyon mRNA ekspresyon p53
2.8.1.RNA Izolasyon.
RNA total te izole nan tisi fwa a dapre metòd Chomzynski ak Sacchi [25] ak Boom et al. [26] lè l sèvi avèk yon Thermo Scientific GeneJET RNA pou pirifye twous yo jwenn nan Thermo Fisher Scientific Inc., Rochester, New York, USA. Yon ti tan, echantiyon fwa yo lysed ak omojeneize nan tanpon lysis, ki gen guanidine thiocyanate kòm yon sèl chaotropic ak -mercaptoethanol ki kapab pwoteje RNA soti nan RNases andojèn. Lè sa a, lisat la melanje ak etanòl epi chaje sou yon kolòn pou pirifye. Sèl chaotropic la ak etanòl lakòz RNA mare nan manbràn silica a pandan y ap lysate la file nan kolòn nan. Imedyatman, enpurte yo efektivman retire nan manbràn nan pa lave kolòn nan ak tanpon lave. Lè sa a, pi RNA eliye anba kondisyon ki ba fòs iyonik ak dlo nuclease-gratis. Nivo izole RNA yo te detèmine ak quantifye lè l sèvi avèk yon espektrofotomèt iltravyolèt (UV) epi pran absorbans nan dansite optik (OD) nan 260nm ak 280 nm. RNA te quantifye ak kalifye dapre [27]fòmil Sambrook ak Russell (RNA(ug/μL)=ODat 260nm×dilution×40ug/mL/1000). Pou chak echantiyon RNA ekstrè, rapò ki genyen ant OD nan 260 nm ak OD nan 280nm ak rapò a varye ant 1.7 ak 2.0 asire pite segondè nan RNA ekstrè.
2.8.2. RT-PCR Assay.RT-PCR essai te aplike lè l sèvi avèk Thermo Scientific Verso 1-Step RT-PCR Reddy Mix Kit (Thermo Fisher Scientific Inc.,
Rochester, New York, USA) pou deteksyon ekspresyon mRNA nan fwa p53.An brèf, nan yon sèl-etap reyaksyon, RNA te ranvèse transkri nan cDNA epi cDNA pwodwi a te anplifye pa Techne 32 Ther-mocycler. Melanj reyaksyon an konsiste de Veso Enzyme Mix(1μL), 2X One-Step PCR ReadyMix(25μL), RT enhancer (25μL), primè pi devan (10μM; 1μL), primè ranvèse(10μM; 1μ), modèl RNA(1 ng; 1.5μL), ak dlo nuclease-gratis pou konplete volim total a 50μL. Pwogram nan monte bisiklèt tèmik gen ladan cDNA sentèz (temp.50 degre, 15 minit, 1 sik), Verso inactivation (temp.95 degre, 2 minit, 1 sik), denaturation (temp.95 degre, 20 segonn), annealing (temp. 55 degre C, 30 segonn), ekstansyon (temp.72 degre, 1 minit), ak ekstansyon final (temp. 72 degre, 5 minit, 1 sik). Nimewo a nan sik denaturasyon ki te swiv pa annealing ak ekstansyon se 35 sik. Apre transkripsyon ranvèse ak anplifikasyon, yo te analize 10μL nan pwodwi PCR sou yon jèl agarose 1.5 pousan tache ak bromur etidyòm nan 1 × Tris Borate EDTA tanpon (TBE) pH 8. 3-8.5. Foto elektwoforetik la te vizyalize ak analize pa sistèm dokiman jèl (GelDocu Advanced), ak valè yo te nòmalize nan kantite -aktin. Sekans pè primè p53 yo te 5'd CAGCGTGATGATGGTAAGGA 3'(pi devan) ak 5'd GCGTTGCTCTGATGGTGA 3'(ranvèse) dapre Asiri [28].

2.9. Envestigasyon istopatolojik. Apre sakrifis ak diseksyon, fwa chak rat yo te retire rapidman, epi answit perfused nan solisyon saline.
Yo te pran moso nan fwa chak rat (3 mm²) epi yo te fikse nan 10 pousan fòmalin tanpon net pandan vennkat èdtan. Fwa fiks yo te voye nan Depatman Patoloji, Fakilte Medsin Veterinè, Beni Suef University, pou plis pwosesis, bloke nan sir, seksyon, ak tach ak ematoksilin ak eosin (H&E) [29]. Seksyon fwa tache yo te egzamine pou deteksyon nòt istopatolojik yo. Nan twa jaden yo chwazi owaza nan chak seksyon (×100), blesi oswa blesi yo te klase kòm absan (0), modere (I), modere (), ak grav (II) pou chanjman, 0 pousan , mwens pase 30 pousan ,30-50 pousan ,ak plis pase 50 pousan , respektivman [30]. Blesi gradye yo enkli koripsyon idropik ak vakuol, enfiltrasyon selil enflamatwa, nekwoz, apoptoz, pwopagasyon selil Kupffer, chanjman gra ak steatoz, veso sangen konjesyone ak sinusoid, ak ipèrplasi nan pawa epitelyal nan kanal bile a.
2.10. Deteksyon imunoistochimik kaspas-3.
Echantiyon fwa ki entegre parafine yo te transfere nan Depatman Patoloji, National Cancer Institute, pou seksyon nan seksyon 5um epè ki te monte sou glisad ki chaje pozitif (Fisher Scientific, Pittsburgh, PA). Yo te trete caspase-3 reyaksyon selon metòd Galaly et al.[31] ak Ahmed ak Ahmed [32]. An brèf, apre rekipere antijèn yo, yo te enkube yon antikò prensipal dilye pou kaspas-3(Santa Cruz Biotechnology, Santa Cruz, CA, USA) ak seksyon fwa pou 1 èdtan. Yo te ajoute antikò segondè biotinilate dilye (DakoCytomation Kit) epi yo te fè enkubasyon pou 15 minit nan 37 degre. Apre sa, peroksidaz refor-konjige ak streptavidin (DakoCytomation Twous) te aplike pou plis 15 minit nan enkubasyon. Konplèks antikò Bound te vizyalize pa reyaksyon an nan 3,3'-diaminobenzidine (DAB) substrate ak counterstaining ak ematoksilin. Tout seksyon fwa yo te enkube nan menm kondisyon yo ak menm dilusyon yo nan antikò ak nan menm peryòd la, kidonk imunostaining la te konparab nan mitan gwoup etid yo diferan. Pou chak preparasyon, yo te fè yon kontwòl negatif (yon glise san yon antikò prensipal). Seksyon yo te vizyalize anba yon mikwoskòp limyè, epi yo te evalye limit iminopozitivite selil yo. Imaj nan seksyon nan fwa a te kaptire lè l sèvi avèk yon kamera dijital (Leica, DM2500M Leica, Wetzlar, Almay). Egzamen ak analiz etikèt yo te fèt lè l sèvi avèk vèsyon lojisyèl gratis ImageJ(1.51d)[33]. Lojisyèl ImageJ yo te itilize pou mezire entansite entegre (an piksèl) reyaksyon pozitif caspase-3.
2.11. Analiz estatistik.
Results were represented in tables and graphs as the mean±standarderror(SE). The data were analyzed by LSD analysis to discern the main effects and to compare various groups with each other using PC-STAT, University of Georgia(USA)[34]. Values of p>0.05 yo te konsidere estatistikman pa siyifikativman diferan, pandan y ap valè p<0.05 were="" significantly="" and="" highly="" significantly="">0.05>
3. Rezilta yo
3.1. Efè sou paramèt serom ki gen rapò ak fonksyon fwa.
Piki diclofenac chak jou nan peritoneal pandan 4 semèn pwovoke yon elevasyon enpòtan (p<0.05)in serum="" alt,="" ast,="" ldh,="" alp,="" and="" ggt="" activities="" as="" well="" as="" serum="" total="" bilirubin="" level.="" the="" cotreatment="" of="" diclofenac-injected="" ani-mals="" with="" naringin="" and/or="" hesperidin="" induced="" a="" decrease="" in="" these="" elevated="" levels.="" while="" the="" cotreatment="" of="" diclofenac-injected="" rats="" with="" naringin="" induced="" a="" significant="" decrease="">0.05)in><0.05)in the="" elevated="" serum="" ast,="" ldh,="" alp,="" ggt,="" and="" total="" bilirubin="" levels,="" it="" produced="" a="" nonsignificant="" effect="" (p="">0.05) sou aktivite ALT la. Kotretman bèt diclofenac-enjekte ak hesperidin pwovoke yon efè enpòtan (p<0.05)on the="" elevated="" alt,="" ast,="" ldh,="" ggt,="" and="" total="" bilirubin="" levels="" while="" it="" failed="" to="" produce="" a="" significant="" effect="" in="" serum="" alp="">0.05)on><0.05). the="" cotreatment="" with="" naringin="" and="" hesperidin="" in="" combination="" successfully="" caused="" a="" significant="" decrease="">0.05).><0.05)in all="" elevated="" parameters="" related="" to="" liver="" function="" including="" alt,="" ast,="" ldh,="" alp,="" ggt,="" and="" total="" bilirubin="" levels.="" moreover,="" the="" treatment="" with="" the="" combination="" of="" naringin="" and="" hesperidin="" appeared="" to="" be="" the="" most="" effective="" in="" improving="" the="" elevated="" ast,="" alp,="" and="" ggt="" activities(table="" 1).="" serum="" albumin="" level,="" on="" the="" other="" hand,="" exhibited="" a="" nonsignificant="" change="" (p="">0.05) nan tout gwoup yo.
3.2.Efè sou estrès oksidatif fwa ak sistèm defans antioksidan.
Piki diclofenac chak jou nan peritoneal pandan 4 semèn pwovoke yon elevasyon enpòtan (p<0.05)in liver="" lpo="" and="" a="" significant="">0.05)in><0.05) in="" liver="" gsh="" con-tent="" and="" gpx="" and="" sod="" activities.="" the="" treatment="" of="" diclofenac-injected="" animals="" with="" naringin="" and/or="" hesperidin="" induced="" a="" significant="">0.05)><0.05)in liver="" lpo.="" narin-gin="" and="" its="" combination="" with="" hesperidin="" were="" more="" potent="" than="" hesperidin="" alone="" in="" decreasing="" the="" elevated="" liver="" lpo="" product.="" while="" the="" treatment="" with="" naringin="" and/or="" hesperidin="" produced="" a="" significant="" increase="">0.05)in><0.05) in="" liver="" gpx="" and="" sod="" activities,="" only="" naringin,="" and="" hesperidin="" in="" combination="" induced="" a="" significant="" increase="">0.05)><0.05) in="" liver="" gsh="" content="" (table="">0.05)>
3.3. Efè sou ekspresyon mRNA p53 fwa.
Jan sa endike nan Figi 2, ekspresyon mRNA p53 pwoteyin proapoptotik la ogmante anpil (p<0.05)in the="" liver="" of="" diclofenac-injected="" rats.="" on="" the="" other="" hand,="" the="" treatment="" with="" naringin,="" hesperidin,="" and="" their="" combination="" produced="" a="" significant="">0.05)in><0.05)decrease in="" p53="" mrna="" expression="" in="" comparison="" with="" diclofenac-injected="" control.="" there="" is="" no="" significant="" difference="" between="" the="" three="" treatments="" when="" compared="" with="" each="">0.05)decrease>
3.4.Efè sou nivo serik TNF-, IL-17, ak-4.Nan Tablo 3, piki diclofenac chak jou intraperitoneal pandan 4 semèn pwovoke yon ogmantasyon enpòtan (p<0.05)in serum="" tnf-αand="" il-17="" levels="" and="" a="" significant="" decrease="" in="" serum="" il-4="">0.05)in>
Kotretman nan rat diclofenac-enjekte ak naringin ak / oswa hesperidin pwovoke yon amelyorasyon siyifikatif (p.<0.05)of altered="" serum="" tnf-a,="" il-17,="" and="" i-4="" levels.="" the="" treatment="" with="" the="" combination="" of="" both="" flavonoids="" was="" the="" most="" potent="" in="" increasing="" the="" lowered="" il-4level;="" the="" effect="" of="" the="" combination="" was="" more="" significantly="" potent="">0.05)of><0.05)as compared="" with="" the="" effect="" of="" either="" naringin="" or="">0.05)as>
3.5. Konklizyon istopatolojik nan fwa.
Figi 3 montre efè naringin ak / oswa hesperidin sou chanjman histolojik fwa nan rat diclofenac-enjekte. Figi 3 (a) montre fwa a ak estrikti nòmal istolojik lobule epatik la. Nan lòt men an, fwa a nan rat diclofenac-enjekte ekspoze make chanjman histolojik ki danjere tankou koripsyon idropik nan epatosit, selil apoptotik, ak enfiltrasyon pòtal ak selil mononikleyè (Figi 3 (b)) anplis vakuolizasyon sitoplasmik nan epatosit ak fokal necrosis epatik. ki asosye ak enfiltrasyon selil enflamatwa fokal (Figi 3 (c)). Chanjman sa yo te amande nan yon sèten mezi nan rat yo te enjekte diclofenac trete ak naringin ki montre sèlman chanjman gra nan epatosit sporadik (Figi 3 (d)). Tretman nan rat diclofenac-enjekte ak hesperidin te pwodwi yon amelyorasyon nan chanjman histolojik fwa yo konpare ak kontwòl la diclofenac-enjekte men yo toujou montre-ited chanjman gra nan epatosit sporadik, ti deklanchman nan selil Kupffer, ak prezans nan kèk selil apoptotik (Figi 3(e)). Menm jan an tou, tretman an nan rat diclofenac-enjekte ak yon konbinezon de naringin ak hesperidin amelyore chanjman histolojik fwa yo konpare ak kontwòl diclofenac-enjekte. Sepandan, fwa a nan rat diclofenac-enjekte ak yon konbinezon de tou de flavonoid ekspoze ti tay pwopagasyon selil Kupffer ak ti tay vakuolization sitoplasmik (Figi 3 (f)). Li te sanble ke efè konbinatwa naringin ak hesperidin te pi pisan nan amelyore achitekti istolojik fwa a.

Nòt chanjman istopatolojik nan tout gwoup yo anrejistre nan Tablo 4. Seksyon fwa nan kontwòl nòmal te montre nòt zewo pou tout blesi istolojik. Rat fwa diclofenac-enjekte yo te montre plizyè klas nan nòt blesi istolojik ki sòti nan klas III rive nan klas 0. Administrasyon hesperidin ak naringin nan rat enjekte diclofenac te lakòz amelyorasyon remakab nan blesi istolojik ki gen ladan koripsyon idropik ak vakuol, enfiltrasyon selil enflamatwa, nekwoz, apoptoz, pwopagasyon selil Kupffer, chanjman gra, steatoz, konjesyon serebral.


FCURE 2: Efè naringin, hesperidin, ak konbinezon yo sou ekspresyon mRNA p53 nan fwa rat yo bay diclofenac. Vle di, ki pataje senbòl diferan, yo diferan anpil nan p<0.05. blood="" vessels="" and="" sinusoids,="" and="" hyperplasia="" of="" the="" epithelial="" lining="" of="" the="" bile="" duct;="" thereby,="" the="" liver="" exhibited="" lower="" grades="" of="" histopathological="" change="" scores="" in="" the="" diclofenac-injected="" groups="" treated="" with="" naringin="" and/or="" hesperidin="" in="" comparison="" with="" diclofenac-injected="" control="" rats.="" the="" combinatory="" effect="" of="" naringin="" and="" hesperidin="" was="" the="" most="" potent="" in="" decreasing="" the="" histopathological="" lesion="">0.05.>
3.6. Esè imunohistochimik.
Seksyon fwa ki tache imunohistochimik yo montre nan Figi 4 epi rezilta analiz imaj yo montre nan Figi 5.
Fotomikrograf yo nan Figi 4 ak done nan Figi 5 te revele ke ekspresyon caspase -3 te ogmante siyifikativman nan rat diclofenac-enjekte. Tretman nan rat diclofenac-enjekte ak naringin, hesperidin ak konbinezon yo te lakòz yon diminisyon enpòtan nan ekspresyon kaspase -3 ki wo nan fwa a. Efè konbinatwa naringin ak hesperidin te pi pisan nan diminye kontni an kaspase -3. Tretman an ak konbinezon an nòmalize ekspresyon fwa caspase-3.
Atik sa a soti nan Medikaman Oksidatif ak Volim Lonjevite Selilè 2021, Atik ID 9990091, 14 paj https://doi.org/10.1155/2021/9990091






